View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_low_36 (Length: 343)
Name: NF13119_low_36
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_low_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 18 - 98
Target Start/End: Original strand, 33061471 - 33061551
Alignment:
| Q |
18 |
gtttctaatattattcattcataaaaatgtttttaagattacaaagttatattgaatttttccccacgtagaaagatcatc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33061471 |
gtttctaatattattcattcataaaaatgtttttaagattacaaagttatattgaatttttccccacgtagaaagatcatc |
33061551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 162 - 190
Target Start/End: Original strand, 33061615 - 33061643
Alignment:
| Q |
162 |
gctgaaaaacatcattagataatagatat |
190 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
33061615 |
gctgaaaaacatcattagataatagatat |
33061643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University