View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_low_42 (Length: 320)
Name: NF13119_low_42
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_low_42 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 121; Significance: 5e-62; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 121; E-Value: 5e-62
Query Start/End: Original strand, 18 - 177
Target Start/End: Complemental strand, 38015571 - 38015412
Alignment:
| Q |
18 |
actaattctgatacttttattttgttnnnnnnnnntcttaatacttttatactcaaatttgtgttgatggtattctttttgcttcttgctctttacatca |
117 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
38015571 |
actaattctgatacttttattttgttaaaaaaaaatcttaatacttttatactcaaatttgtgttgatggtattctttttgctttttgctgtttacatca |
38015472 |
T |
|
| Q |
118 |
gtggcggttcaacactaaaaactttgtttgcttttcgtatttacaaacttcgttttcatg |
177 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38015471 |
gtggcggttcaacactagaaactttgtttgcttttcgtatttacaaacttcgttttcatg |
38015412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 58 - 177
Target Start/End: Original strand, 26496685 - 26496797
Alignment:
| Q |
58 |
atacttttatactcaaatttgtgttgatggtattctttttgcttcttgctctttacatcagtggcggttcaacactaaaaactttgtttgcttttcgtat |
157 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||||||| || |||||||| ||||||||||||||||| |||||| |||| |||||||||| |
|
|
| T |
26496685 |
atacttctttactcaaatttgtgttaatggtattcttttttatt-------tttacatccgtggcggttcaacactagaaacttagtttacttttcgtat |
26496777 |
T |
|
| Q |
158 |
ttacaaacttcgttttcatg |
177 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
26496778 |
ttacaaacttcggtttcatg |
26496797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University