View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_low_48 (Length: 267)
Name: NF13119_low_48
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_low_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 1 - 143
Target Start/End: Complemental strand, 38236423 - 38236281
Alignment:
| Q |
1 |
cagagagaaagaaatgatgcatctgggaagagcaaatggtctaagtcttaagtgcatcatcctaaagaagaatgtgaagaaagaaagttgtccaatctca |
100 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
38236423 |
cagaaagaaagaaatgatgcatctgggaagagcaaatggtctaagtcttaagtgcatcatcctaaagaagaatgtgacgaaagaaagttgtccaatctca |
38236324 |
T |
 |
| Q |
101 |
actaatcaaattagcatagagttaaacaagacaagaagtgctt |
143 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38236323 |
actaatcaaattagcatagagttaaacaagacaagaagtgctt |
38236281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 172 - 250
Target Start/End: Complemental strand, 38236252 - 38236174
Alignment:
| Q |
172 |
tttacatttatcaagatgtacatttttattagtttttacacaagcaatttcgtgagaaaaagactcaacacaagatgaa |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38236252 |
tttacatttatcaagatgtacatttttattagtttttacacaggcaatttcgtgagaaaaagactcaacacaagatgaa |
38236174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University