View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_low_54 (Length: 256)
Name: NF13119_low_54
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 134
Target Start/End: Original strand, 29122274 - 29122407
Alignment:
| Q |
1 |
cttctttgtttcattgtgatgatatatctatgttaatgttcctgtggcccatatatgggacagaatatgtgaagttgccatcttcaagacatttgcgtct |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29122274 |
cttctttgtttcattgtggtgatatatctatgttaatgttcctgtggcccatatatgggacagaatatgtgaagttgccatcttcaagacatttgcgtct |
29122373 |
T |
 |
| Q |
101 |
gtgtcttatgtacaaataatattgaatataccta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29122374 |
gtgtcttatgtacaaataatattgaatataccta |
29122407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 154 - 246
Target Start/End: Original strand, 29122479 - 29122571
Alignment:
| Q |
154 |
ggaggaacaaaatggatggattggatgataatgggtggataaaacaattcattatcaatccactaaaaattattttaaaaaatttaagaatta |
246 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29122479 |
ggagtaacaaaatggatggattggatgataatgggtggataaaacaatccattatcgatccactaaaaattgttttaaaaaatttaagaatta |
29122571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University