View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_low_63 (Length: 240)
Name: NF13119_low_63
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_low_63 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 73; Significance: 2e-33; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 127 - 230
Target Start/End: Original strand, 51363555 - 51363659
Alignment:
| Q |
127 |
aatcaaatgctttcaaattctctctcatattaatctgctaatcttataatcatctaacaaattactatattcaatctgcta-atcttgggtttacctttg |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| | | | |||||||||||||||||| |
|
|
| T |
51363555 |
aatcaaatgctttcaaattctctctcatattaatctgctaatcttacaatcatctaacaaattactatattcaaatttcaacatcttgggtttacctttg |
51363654 |
T |
|
| Q |
226 |
cttct |
230 |
Q |
| |
|
|||| |
|
|
| T |
51363655 |
tttct |
51363659 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 20 - 81
Target Start/End: Original strand, 51363485 - 51363546
Alignment:
| Q |
20 |
aaatctgttaccctttctatgaatgctcaaggagtgccttgatacaaagacagttgggcgct |
81 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51363485 |
aaatctgttaccctttctatgaatgctcaaggagtgccttgatacaaagacagttgggcgct |
51363546 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University