View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13119_low_67 (Length: 225)
Name: NF13119_low_67
Description: NF13119
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13119_low_67 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 22 - 210
Target Start/End: Complemental strand, 54216596 - 54216408
Alignment:
| Q |
22 |
gcccaaagtattggactgccaaaatcacaaaaacacacattaaaagaaaccaaagtgattaagaaattgaggagtaaaatattcttcaaatcaaagacat |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54216596 |
gcccaaagtattggactgccaaaatcacaaaaacacacattaaaagaaaccaaagtgattaagaaattgaggagtaaaatattcttcaaatcaaagacat |
54216497 |
T |
 |
| Q |
122 |
gattgcagccaagtgttggcaaatttgtcaagattacctgattcctacaactaccttaaagtcatcttctaatgacctcttgatatatt |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54216496 |
gattgcagccaagtgttggcaaatttgtcaagattacctgattcctacaactaccttaaagtcatcttctaatgacctcttgatatatt |
54216408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University