View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1311_low_18 (Length: 299)

Name: NF1311_low_18
Description: NF1311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1311_low_18
NF1311_low_18
[»] chr1 (1 HSPs)
chr1 (196-299)||(6069666-6069773)


Alignment Details
Target: chr1 (Bit Score: 79; Significance: 6e-37; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 196 - 299
Target Start/End: Complemental strand, 6069773 - 6069666
Alignment:
196 gacaaaaaataaatattattcatatttatttagtttttaa----caaatattattctttcttgtagataactcaattgaaaaattgatgaataaatgaat 291  Q
    ||||||||||||||||||||||||||||||||||| ||||    ||||||||||||||||||||||||||||||||||||||| |||||||||| |||||    
6069773 gacaaaaaataaatattattcatatttatttagttattaattaacaaatattattctttcttgtagataactcaattgaaaaactgatgaataactgaat 6069674  T
292 gacagctt 299  Q
    ||||||||    
6069673 gacagctt 6069666  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University