View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1311_low_26 (Length: 217)

Name: NF1311_low_26
Description: NF1311
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1311_low_26
NF1311_low_26
[»] chr3 (1 HSPs)
chr3 (1-130)||(19858908-19859037)
[»] chr8 (1 HSPs)
chr8 (16-100)||(22688853-22688937)


Alignment Details
Target: chr3 (Bit Score: 110; Significance: 1e-55; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 130
Target Start/End: Original strand, 19858908 - 19859037
Alignment:
1 acagaaaagaagtgtaagttcattaaaatgtagacctcatgctgagattccggatcatgcttcttgtgacactgttacttttggaaaatcttgcgatgat 100  Q
    |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||    
19858908 acagaaaagaagtgtaagttcattaaaatgtagaccacatgctgagattccggatcatgctgcttgtgacactgttacttttggaaaatcttgtgatgat 19859007  T
101 cgttggaaaaactacaagggtggtaatatt 130  Q
     |||||||||||||||| ||||||||||||    
19859008 ggttggaaaaactacaacggtggtaatatt 19859037  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 16 - 100
Target Start/End: Complemental strand, 22688937 - 22688853
Alignment:
16 aagttcattaaaatgtagacctcatgctgagattccggatcatgcttcttgtgacactgttacttttggaaaatcttgcgatgat 100  Q
    |||||||| ||||| |||||||||||| ||||||||  | | || |  ||||| |||||||||||||||||||||| ||||||||    
22688937 aagttcatcaaaatatagacctcatgccgagattcctaaacttgttggttgtggcactgttacttttggaaaatctagcgatgat 22688853  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University