View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13121_high_8 (Length: 238)
Name: NF13121_high_8
Description: NF13121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13121_high_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 6360192 - 6360412
Alignment:
| Q |
18 |
agttacgtataaatcatttggttatatctcaatttacttggaaatattcaaccatgatgtttctattggttttaattaatatattctaacgaattttaaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360192 |
agttacgtataaatcatttggttatatctcaatttacttggaaatattcaaccatgatgtttctattggttttaattaatatattctaacgaattttaaa |
6360291 |
T |
|
| Q |
118 |
attgacagtcgcgataataatcatgttcgcatcgtgttctttgatattatataaaatgcatgtatggattgacggtgaaggtagtagaacacggtgagtc |
217 |
Q |
| |
|
|| ||| ||||| ||||||||||||||||||||| | |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6360292 |
atcgacggtcgccataataatcatgttcgcatcgcgatctttgatattatataaaatacatgtatggattgacggtgaaggtagtagaacacggtgagtc |
6360391 |
T |
|
| Q |
218 |
attgtgattgcaacataagct |
238 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
6360392 |
attgtgattgcaacacaagct |
6360412 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University