View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13121_low_5 (Length: 257)
Name: NF13121_low_5
Description: NF13121
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13121_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 138; Significance: 3e-72; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 57 - 218
Target Start/End: Original strand, 26644142 - 26644302
Alignment:
| Q |
57 |
gttgagctgacataaactcattggggggagaaatgtattttcgcacagtaaatatttttgttgaggcatacattaacaaacttcggtagtatccacatgt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26644142 |
gttgagctgacataaactcattggggggagaaatgtatgttcgcacagtaaatatttt-gttgaggcatacattaacaaacttcggtcgtatccacatgt |
26644240 |
T |
 |
| Q |
157 |
atcagataatcctacaacatccatatcacaacatgatgcatatgtattaccccacgcgggtt |
218 |
Q |
| |
|
||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26644241 |
atcagatcatcctacaacatccatataacaacatgatgcatatgtattaccccacgcgggtt |
26644302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University