View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13122_high_11 (Length: 296)
Name: NF13122_high_11
Description: NF13122
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13122_high_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 5e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 17 - 142
Target Start/End: Complemental strand, 50419770 - 50419645
Alignment:
| Q |
17 |
aacacaagtattgacaatttgcactacatacttagggattccagttagagtctctctactttgtgaaatgcttatgtctttgtttgtgcaagaacctaat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50419770 |
aacacaagtattgacaatttgcactacatacttagggattccagttagagtctctctactttgtgaaatgcttatgtctttgtttgtgcaagaacctaat |
50419671 |
T |
 |
| Q |
117 |
gaaaaccacacacatacacatattag |
142 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
50419670 |
gaaaaccacacacatacacatattag |
50419645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 169 - 288
Target Start/End: Complemental strand, 50419618 - 50419499
Alignment:
| Q |
169 |
tcatctcaggtttagaatataaaaggattacattattataaattgacaagtgcataaatattaaataccatgccatgaaaatttagtggaagtagagtgt |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50419618 |
tcatctcaggtttagaatataaaaggattacattattataaattgacaagtgcataaatattaaataccatgccatgaaaatttagtggaagtagagtgt |
50419519 |
T |
 |
| Q |
269 |
gcatgttctgctttcactga |
288 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
50419518 |
gcatgttctgctttcactga |
50419499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University