View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13123_low_3 (Length: 256)
Name: NF13123_low_3
Description: NF13123
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13123_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 55865612 - 55865857
Alignment:
| Q |
1 |
cgttgttgttctgttctcctatgcggcggcgaggaatcaatttgcgcctggtggatggagtcccatcgatgacatcaacgatcctcatgtcaccgaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55865612 |
cgttgttgttctgttctcctatgcggcggcgaggaatcaatttgcgcctggtggatggagtcccatcgatgacatcaacgatcctcatgtcaccgaaatc |
55865711 |
T |
 |
| Q |
101 |
gccaatttcgccgtcactgagtatgacaggcgaagtggagcgaagctgaagttcgagaaagttatcaacggtgaatctcaggtggttgctgggactaatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55865712 |
gccaatttcgccgtcactgagtatgacaggcgaagtggagcgaagctgaagttcgagaaagttatcaacggtgaatctcaggtggttgctgggactaatt |
55865811 |
T |
 |
| Q |
201 |
accgtctcaccctttccgctgccgatggttcctattctaagaatta |
246 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55865812 |
accgtctcaccctttccgcttccgatggttcctattctaagaatta |
55865857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 146 - 210
Target Start/End: Original strand, 5520811 - 5520875
Alignment:
| Q |
146 |
ctgaagttcgagaaagttatcaacggtgaatctcaggtggttgctgggactaattaccgtctcac |
210 |
Q |
| |
|
|||||||||||||| || |||| |||||||| || || ||||| |||||||| ||||||||||| |
|
|
| T |
5520811 |
ctgaagttcgagaaggtcgtcaagggtgaatcacaagttgttgcagggactaactaccgtctcac |
5520875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University