View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13124_high_11 (Length: 272)
Name: NF13124_high_11
Description: NF13124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13124_high_11 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 71 - 272
Target Start/End: Original strand, 27866732 - 27866933
Alignment:
| Q |
71 |
aagtgttaagatttgtgtcctaggtgctcagtttctccctaacactttcaaattcaaactattatatcaacagcgtgctttgcatttaactttctctact |
170 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27866732 |
aagtgttaagatttgtgtcctaggtgctcaatttctcccaaacactgtcaaattcaaactattatatcaacagcgtgctttgcatttaactttctttact |
27866831 |
T |
 |
| Q |
171 |
attgcattctaggttgccagaaggaaggagaaagaagcagcagctgcacacaaagaagcaaacattgctttatcaaaacacctcggaccgggagctgctt |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
27866832 |
attgcattctaggttgccagaaggaaggagaaagaagcagcagctgcacacaaagaggcaaacattgctttatcgaaacaccttggaccgggagctgctt |
27866931 |
T |
 |
| Q |
271 |
ca |
272 |
Q |
| |
|
|| |
|
|
| T |
27866932 |
ca |
27866933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University