View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13124_low_11 (Length: 347)
Name: NF13124_low_11
Description: NF13124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13124_low_11 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 11 - 333
Target Start/End: Original strand, 48357221 - 48357543
Alignment:
| Q |
11 |
cataggggaacatggcgtggatttgatgtggcagtgaagtgcatttcacctgaattctttcgcacaaatgcaaacggtgttgaattctttgctcaagagg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357221 |
cataggggaacatggcgtggatttgatgtggcagtgaagtgcatttcacctgaattctttcgcacaaatgcaaacggtgttgaattctttgctcaagagg |
48357320 |
T |
 |
| Q |
111 |
ttgaaactctctcaaagcaacgccacaggtttgtgcttaatctaatgggtgcatgtcttgaccctcctaatcatgcttgggttgttactgaatatctaag |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
48357321 |
ttgaaactctctcaaagcaacgccacaggtttgtgcttaatctaatgggtgcatgtcttgaccctcctaatcatgcttgggtggttactgaatatctaag |
48357420 |
T |
 |
| Q |
211 |
caccacacttaaggagtggctttatggtcctggcaaaagacgcagagatagaattgtgccacttcctcctttcaaagaaagactaacaagggtcatagag |
310 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48357421 |
caccacacttaaggagtggctttatggtcctggcaaaagacgcagagatagaattgtgccacttcctcctttcaaagaaagactaacaagggtcatagag |
48357520 |
T |
 |
| Q |
311 |
atagcccaagctatgcagtatct |
333 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
48357521 |
atagcccaagctatgcagtatct |
48357543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University