View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13124_low_15 (Length: 227)
Name: NF13124_low_15
Description: NF13124
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13124_low_15 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 7 - 227
Target Start/End: Original strand, 42243031 - 42243247
Alignment:
| Q |
7 |
gggttgggtttacgcgtcatccagtattttttaaactgaaatgctaaagacaaggaatttagatacaacgaacccttcacaatacatgtaacattttttc |
106 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42243031 |
gggttgggtttacgcctcatccagtattttttaaactgaaatgctaaagacaaggaatttagatacaacgaacccttcacaatacatgtaacattttttc |
42243130 |
T |
|
| Q |
107 |
attgcaaatttatttgttgatttcccatgtttgacgtacgccatccttccatgtattctgtccaatggtgaattgtgattggttgattgcttattcggga |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
42243131 |
attgcaaatttatttgttgatttcccatgtttg----acgccatccttccatgtattctgtccaatggtgaattgtgattggttgattgcttatttggga |
42243226 |
T |
|
| Q |
207 |
tgatttcgggatgttccacct |
227 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
42243227 |
tgatttcgggatgttccacct |
42243247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 157 - 203
Target Start/End: Complemental strand, 12890417 - 12890371
Alignment:
| Q |
157 |
atgtattctgtccaatggtgaattgtgattggttgattgcttattcg |
203 |
Q |
| |
|
|||||||| | ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12890417 |
atgtattccgcccaatagtgaattgtgattggttgattgcttattcg |
12890371 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University