View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13125_high_25 (Length: 324)
Name: NF13125_high_25
Description: NF13125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13125_high_25 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 216; Significance: 1e-118; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 88 - 307
Target Start/End: Complemental strand, 11517396 - 11517177
Alignment:
| Q |
88 |
tttactggtagcttaccttggtaacgtaatccatctcaatgaattggaaatgaaagccaacactaccaaaaaggggagctacaaaagaacatgcacggga |
187 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11517396 |
tttactggtagcttaccttggtaacgtaatccatctcaatgaactggaaatgaaagccaacactaccaaaaaggggagctacaaaagaacatgcacggga |
11517297 |
T |
 |
| Q |
188 |
aaaagcagcaacctcgatcatattttcgttgacgatggcatttgctagctctttgaatgcatctgcgattttagcgagatgcttttcatcgactgctgtc |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11517296 |
aaaagcagcaacctcgatcatattttcgttgacgatggcatttgctagctctttgaatgcatctgcgattttagcgagatgcttttcatcgactgctgtc |
11517197 |
T |
 |
| Q |
288 |
gtggaagccactcttcttcc |
307 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11517196 |
gtggaagccactcttcttcc |
11517177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 18 - 50
Target Start/End: Complemental strand, 11517457 - 11517425
Alignment:
| Q |
18 |
acaaataagatcacatattcacatacatgttac |
50 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
11517457 |
acaaataagatcccatattcacatacatgttac |
11517425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University