View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13125_high_41 (Length: 226)
Name: NF13125_high_41
Description: NF13125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13125_high_41 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 59 - 186
Target Start/End: Complemental strand, 4922963 - 4922841
Alignment:
| Q |
59 |
cataaattcgaaagacacaaacacatactttgaaagagacacacacaaagagcataaatttgcaagacaactatatgaatatgatctagttagttagacc |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
4922963 |
cataaattcgaaagacacaaacacatactttgaaagagacacactcaaagagcataaatttgcaagacaactat------atgatctagttagttagacc |
4922870 |
T |
 |
| Q |
159 |
aaagacca-ttaagtccgtattaacatca |
186 |
Q |
| |
|
|||||||| ||| |||||||||||||||| |
|
|
| T |
4922869 |
aaagaccatttatgtccgtattaacatca |
4922841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 34 - 66
Target Start/End: Complemental strand, 4923006 - 4922974
Alignment:
| Q |
34 |
gacacaaacacatactcccaatgagcataaatt |
66 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4923006 |
gacacaaacacatactcccaatgagcataaatt |
4922974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University