View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13125_low_20 (Length: 386)
Name: NF13125_low_20
Description: NF13125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13125_low_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 220 - 386
Target Start/End: Original strand, 3194566 - 3194732
Alignment:
| Q |
220 |
taatcttcgagtattaacttggagcatgtggagtatagcgaatttgagaatgatgcacgtagtattaattgaatgatgagagtatatacttgaaacctgc |
319 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
3194566 |
taatcttcgagtattaacttggagcatgtggagtataacgaatttgagaatgatgcacgtagtattaattgaatgatgaaagtatatacttgaaacctgc |
3194665 |
T |
 |
| Q |
320 |
tagaacaagaggaacactgatatccagggtaaaacaaacagattagagtatgcagtttaaaacgagc |
386 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
3194666 |
tagaacaagaggaacactgatatccagggtaaaacaaacagagtagagtatgcagtttaaaacgagc |
3194732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University