View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13125_low_40 (Length: 236)
Name: NF13125_low_40
Description: NF13125
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13125_low_40 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 141; Significance: 5e-74; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 20 - 236
Target Start/End: Complemental strand, 44038250 - 44038040
Alignment:
| Q |
20 |
tgtgtgtgtataaatcctaaaattttgtttggtttatcattcaaggtatatttgtaattgttacataaacaaacatctaatctaactatcctcctatgaa |
119 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44038250 |
tgtgtgtacataaatcctaaaattttgtttggtttatgattcaaggtatatttgtaattgttacataaacaaacatctaa-----ctatcctcctatgaa |
44038156 |
T |
 |
| Q |
120 |
aagnnnnnnnnntctaacaatccacaaaattacatgagaaattcatattctggccaaattgtaacaacatttaaatgatgaatgaaactgacattaactt |
219 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
44038155 |
aagaaaaaaaa-tctaacaatccacaaaattacatgagaaattcatattccggccaaattgtaacaacattcaaatgatgaatgaaactgacgttaactt |
44038057 |
T |
 |
| Q |
220 |
atatgcgctgatgtgac |
236 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
44038056 |
atatgcgctgatgtgac |
44038040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University