View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13126_high_5 (Length: 369)
Name: NF13126_high_5
Description: NF13126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13126_high_5 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 285; Significance: 1e-160; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 2018229 - 2018587
Alignment:
| Q |
1 |
gaaaacctccattgcaccgtaattattttggggatgcaacggttagctaatttctctcccatatctaccatattgagtatctcnnnnnnnnnnnnnn-gt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||| |||||||||||| || |
|
|
| T |
2018229 |
gaaaacctccattgcaccgtaattattttgggcatgcaacagttagctaatttctctcccatatctaccacattgagtatctcttttttttttttgttgt |
2018328 |
T |
 |
| Q |
100 |
ctcgtccaaagattacggaattaacccttgcacaatattaaccctacaaaaataaaactagggttcacacttatacctcgctgtgaacaagaacaaccat |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018329 |
ctcgtccaaagattacggaattaacccttgcacactattaaccctacaaaaataaaactagggttcacacttatacctcgctgtgaacaagaacaaccat |
2018428 |
T |
 |
| Q |
200 |
ggaatcactacctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactc |
299 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018429 |
ggaatcactacctgacgacgttctgtgtcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactc |
2018528 |
T |
 |
| Q |
300 |
tggctctccctccgttccttcgaccttgatgacaactacttttccgacttccacaggtt |
358 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2018529 |
tggctctccttccgttccttcgaccttgatgacaactacttttccgacttccacaggtt |
2018587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 207 - 322
Target Start/End: Original strand, 2005585 - 2005700
Alignment:
| Q |
207 |
ctacctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactctggctct |
306 |
Q |
| |
|
||||||||||| ||| | |||||||||||| | |||||||||||| ||||| |||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
2005585 |
ctacctgacgatcttcgatgtcacattctgtcatgccttccgacgagagatgcgtctgctactagccttctgtcaaagagatggaaaccactttggctct |
2005684 |
T |
 |
| Q |
307 |
ccctccgttccttcga |
322 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
2005685 |
cactccgttccttcga |
2005700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 210 - 319
Target Start/End: Original strand, 2011762 - 2011871
Alignment:
| Q |
210 |
cctgacgacgttctgtatcacattctgtcgttccttccgacgagggatgctgttgctactagccttctgtcaaagagatggaaaccactctggctctccc |
309 |
Q |
| |
|
|||||||| |||| || ||||||||| || |||||||| ||||| ||||||| |||||| || ||||| |||||||||||||||||||| |||||||| | |
|
|
| T |
2011762 |
cctgacgatgttcggtgtcacattctctcattccttccaacgagagatgctgctgctacaagtcttctatcaaagagatggaaaccactttggctctcgc |
2011861 |
T |
 |
| Q |
310 |
tccgttcctt |
319 |
Q |
| |
|
|||||||||| |
|
|
| T |
2011862 |
tccgttcctt |
2011871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University