View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13126_high_6 (Length: 324)
Name: NF13126_high_6
Description: NF13126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13126_high_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 138; Significance: 4e-72; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Original strand, 39272826 - 39272963
Alignment:
| Q |
1 |
acttcatggacttggtaattgtaggagttggaaggacaccaaccgcgatatatgatgttttgtttttccatttcctatatatatggaattgaaagtgccc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39272826 |
acttcatggacttggtaattgtaggagttggaaggacaccaaccgcgatatatgatgttttgtttttccatttcctatatatatggaattgaaagtgccc |
39272925 |
T |
|
| Q |
101 |
agttctgtttgtgaatggtgttgaaattgtgttcctac |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39272926 |
agttctgtttgtgaatggtgttgaaattgtgttcctac |
39272963 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 225 - 306
Target Start/End: Original strand, 39273006 - 39273087
Alignment:
| Q |
225 |
ttgagtatatatgtccattagttatatattctgtaatgatataaagtgattggataggatctaatacctctccctccttttt |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39273006 |
ttgagtatatatgtccattagttatatattctgtaatgatataaagtgattggataggatctaatacctctccctccttttt |
39273087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University