View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13126_low_12 (Length: 249)
Name: NF13126_low_12
Description: NF13126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13126_low_12 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 2 - 215
Target Start/End: Original strand, 53018575 - 53018788
Alignment:
| Q |
2 |
gcaaaggggaaattgcacaaatgtggcaacgtaaatatgaaggacacgttggcaatatttggtggaatgggtttggtgtggtgattggtttat--gagaa |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
53018575 |
gcaaaggggaaattgcacaaatgtggcaacgtaaatatgaaggacacgttggcaatatttggtggaatgggtttgatgtggtgattggtttatgagagaa |
53018674 |
T |
|
| Q |
100 |
ttaagtaaatacactgatggatagcggcggtgatcaaagaaaaatgaatactcaggaaggaaacaaataatgaaaaatagaagagacagatgaaaaccta |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||| ||||||||||| ||||||||| |
|
|
| T |
53018675 |
ttaagtaaatacactgatggatagcggcggtgatcaaagaaaaatgaatactcaggaaggaaaacaataatgacaaaaagaagagacag--gaaaaccta |
53018772 |
T |
|
| Q |
200 |
agctcttgataccatg |
215 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
53018773 |
agctcttgataacatg |
53018788 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University