View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13126_low_15 (Length: 206)
Name: NF13126_low_15
Description: NF13126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13126_low_15 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 164; Significance: 7e-88; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 164; E-Value: 7e-88
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 8105114 - 8104938
Alignment:
| Q |
13 |
aaaataaataaataaagaaatgtagtttgagttggggaacatgttgcatcaataggttacggaaaatgctgacacatcttatagccattcgttttgtttt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8105114 |
aaaataaataaataaagaaatgtagtttgagttggggaacatgttgcatcaataggttacggaaaatgctgacacatcttatagccattcgttttgtttt |
8105015 |
T |
|
| Q |
113 |
acttgttatagtgttccattgatcaaactgtgttttcaattatcccaaatacatgttgtactccatggatgaaaaaatt |
191 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8105014 |
acttgttatagtcttccattgatcaaac--tgttttcaattatcccaaatacatgttgtactccatggatgaaaaaatt |
8104938 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University