View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13126_low_2 (Length: 807)
Name: NF13126_low_2
Description: NF13126
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13126_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-111; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-111
Query Start/End: Original strand, 590 - 806
Target Start/End: Complemental strand, 23522496 - 23522280
Alignment:
| Q |
590 |
tggtgggacctataaaacagagaggggaaggaaaaggtggggactcttacattacatctatggatggacaattgggtctgatccatctcagagtgaattg |
689 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522496 |
tggtgggacctataaaacagagaggggaaggaaaaggtggggactcttacattacatctatggatggacaattgggtctgatccatctcagagtgaattg |
23522397 |
T |
|
| Q |
690 |
cctgacaatcgccacaagactgcctttgccttctcaaagtaccacctccctttcacttatttttggatccattcattcacatccatttctataaactcaa |
789 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
23522396 |
cctgacaatcgccacaagactgcctttgccttctcaaagtaccacctccctttcacttatttttggatccattcattcacatccatttctataaactcta |
23522297 |
T |
|
| Q |
790 |
tagtattatctacccac |
806 |
Q |
| |
|
||||| ||| ||||||| |
|
|
| T |
23522296 |
tagtagtatatacccac |
23522280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 158; E-Value: 1e-83
Query Start/End: Original strand, 75 - 232
Target Start/End: Complemental strand, 23523014 - 23522857
Alignment:
| Q |
75 |
gtagagatgtggatcagagaaagtagtagcatgtaccatagttgattgaaggtgttgtcgttttgcgtgttgacgttctcttttgtgtgcgttttgatga |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523014 |
gtagagatgtggatcagagaaagtagtagcatgtaccatagttgattgaaggtgttgtcgttttgcgtgttgacgttctcttttgtgtgcgttttgatga |
23522915 |
T |
|
| Q |
175 |
ccacctaaggcttgtgaagtaggaaagtttctacaacagtaatgacattcaaatcttc |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522914 |
ccacctaaggcttgtgaagtaggaaagtttctacaacagtaatgacattcaaatcttc |
23522857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 157; E-Value: 5e-83
Query Start/End: Original strand, 316 - 472
Target Start/End: Complemental strand, 23522770 - 23522614
Alignment:
| Q |
316 |
tccggagactcagaggactcgtcttcggtggcgccaccaccgaattcgataccgaagaggcggatgcctttctctttgttagtaggaggaggacggatga |
415 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522770 |
tccggagactcagaggactcgtcttcggtggcgccaccaccgaattcgataccgaagaggcggatgcctttctctttgttagtaggaggaggacggatga |
23522671 |
T |
|
| Q |
416 |
agggaagttgagagaatgactcaacattcattaagtcatgagtttctctttcaatga |
472 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23522670 |
agggaagttgagagaatgactcaacattcattaagtcatgagtttctctttcaatga |
23522614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University