View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13127_low_4 (Length: 220)
Name: NF13127_low_4
Description: NF13127
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13127_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 2020656 - 2020453
Alignment:
| Q |
1 |
gggcaagaagaacagaagagactgcaatcatagaaccctctataacaggaatatgtataaatcatctaaaattagtgttgtcaatcacaaaaaatagcaa |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
2020656 |
gggcaagaagaacagaagagacttcaatcatagaaccctctataacaggaatatgtataaatcatctaaaattagtgttgtcaatcgcaaaaaatagcaa |
2020557 |
T |
|
| Q |
101 |
cttgttcaaattcccttacgctgcactgttatagtgccactataaccgctttttgacagcagtgttactaaatggtggtcatggcaccaccatggcagtg |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
2020556 |
cttgttcaaattcccttacgctgc-ctgttatagtgccactataaccgctttttgacagcagtgttactaaatggtggtcatggcaccaccatggcggtg |
2020458 |
T |
|
| Q |
201 |
ttttg |
205 |
Q |
| |
|
||||| |
|
|
| T |
2020457 |
ttttg |
2020453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 107 - 196
Target Start/End: Complemental strand, 2018053 - 2017964
Alignment:
| Q |
107 |
caaattcccttacgctgcactgttatagtgccactataaccgctttttgacagcagtgttactaaatggtggtcatggcaccaccatggc |
196 |
Q |
| |
|
||||| || |||||||||||||| |||| ||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
2018053 |
caaatccctttacgctgcactgtcatagcgccactataaccgctttttgacaacagtgttactaaatggtggtcgtggcaccaccatggc |
2017964 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 66 - 147
Target Start/End: Complemental strand, 2035524 - 2035443
Alignment:
| Q |
66 |
ctaaaattagtgttgtcaatcacaaaaaatagcaacttgttcaaattcccttacgctgcactgttatagtgccactataacc |
147 |
Q |
| |
|
||||||| ||||||||||||| |||||||||| || ||||||||||||| |||||||||| |||||||| ||||||||||| |
|
|
| T |
2035524 |
ctaaaatcagtgttgtcaatcgcaaaaaataggaatttgttcaaattcctttacgctgcattgttatagccccactataacc |
2035443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 91
Target Start/End: Complemental strand, 2018100 - 2018050
Alignment:
| Q |
41 |
tataacaggaatatgtataaatcatctaaaattagtgttgtcaatcacaaa |
91 |
Q |
| |
|
||||||| ||||||||||||||||||||||| | |||| ||||||||||| |
|
|
| T |
2018100 |
tataacacaaatatgtataaatcatctaaaatcaatgttatcaatcacaaa |
2018050 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University