View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13128_low_15 (Length: 271)
Name: NF13128_low_15
Description: NF13128
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13128_low_15 |
 |  |
|
| [»] scaffold1191 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 18 - 175
Target Start/End: Original strand, 34174477 - 34174634
Alignment:
| Q |
18 |
agaaccaaaggaaaaacaagagcagcacctaacatataaatacattatccctatctagcatttcgtcttatctccattataataattcatttcaagagtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
34174477 |
agaaccaaaggaaaaacaagagcagcacctaacatataaatacattatccctatctagcatttcttcttatctccattataataattcatttcaagagtc |
34174576 |
T |
 |
| Q |
118 |
tcatatcttcttatgaacaaggtcatatgaaatatgaacacattctaaaaatagaaaa |
175 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34174577 |
tcatatcttcttatgaacaaggtcatatgaaatatgaacacattctaaaaatagaaaa |
34174634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1191 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold1191
Description:
Target: scaffold1191; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 98 - 129
Target Start/End: Complemental strand, 498 - 467
Alignment:
| Q |
98 |
aataattcatttcaagagtctcatatcttctt |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
498 |
aataattcatttcaagagtctcatatcttctt |
467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University