View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13129_high_13 (Length: 359)

Name: NF13129_high_13
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13129_high_13
NF13129_high_13
[»] chr8 (1 HSPs)
chr8 (195-337)||(10470124-10470266)


Alignment Details
Target: chr8 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 195 - 337
Target Start/End: Original strand, 10470124 - 10470266
Alignment:
195 gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc 294  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10470124 gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc 10470223  T
295 ttttctggaactttatgttctttcactattggattggtctgtg 337  Q
    ||||| ||||||||||||||||||||| |||||||||||||||    
10470224 ttttcaggaactttatgttctttcactgttggattggtctgtg 10470266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University