View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_high_13 (Length: 359)
Name: NF13129_high_13
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_high_13 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 135; Significance: 3e-70; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 135; E-Value: 3e-70
Query Start/End: Original strand, 195 - 337
Target Start/End: Original strand, 10470124 - 10470266
Alignment:
| Q |
195 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470124 |
gctatgcgttctttattctgctgcgtattacggaccacgttacctattgagcaaggagcagcatttcaactctcgagtacttgagagatcatgatgtttc |
10470223 |
T |
 |
| Q |
295 |
ttttctggaactttatgttctttcactattggattggtctgtg |
337 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10470224 |
ttttcaggaactttatgttctttcactgttggattggtctgtg |
10470266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University