View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_high_18 (Length: 249)
Name: NF13129_high_18
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 11 - 84
Target Start/End: Original strand, 49496123 - 49496196
Alignment:
| Q |
11 |
atgaacaaattaaactgagacaaatctctattaatatgataattctactagaaccgttcattctaagaattaaa |
84 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49496123 |
atgaacaaattaaactgagacaaatctatattaatatgataattctactagaaccgttcattctaagaattaaa |
49496196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University