View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_high_19 (Length: 249)
Name: NF13129_high_19
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_high_19 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 1 - 239
Target Start/End: Original strand, 8793719 - 8793957
Alignment:
| Q |
1 |
tttatcagttatactctttctctatcaattactttataattatttaaagacaggagtatatgtttaaaatttgcttattaatcaaaacatannnnnnngg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
8793719 |
tttatcagttatactctttctctatcaattactttataattattaaaagacaagagtatatgtttaaaatttgcttattaatcaaaacatatttttttgg |
8793818 |
T |
|
| Q |
101 |
aaaaacaatctattaagtacatagcaacatagagagtatactttgcaagagcgatataatggttggttgttcaggtgtttgacctttcgttcattcactg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
8793819 |
aaaaacaatctattaagtacatagcaacatagagagtatactttgcaagagccatataatggttgtttgttcaggtgtttgacctttcgttcattcactg |
8793918 |
T |
|
| Q |
201 |
gacatttgaattgtgaagtagctacttgagtaatttctt |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8793919 |
gacatttgaattgtgaagtagctacttgagtaatttctt |
8793957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University