View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_high_21 (Length: 247)
Name: NF13129_high_21
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_high_21 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 157 - 230
Target Start/End: Complemental strand, 8793460 - 8793387
Alignment:
| Q |
157 |
tatgttttccgtaaggaaaagtagtagcgtcacttgccacatctaaaacccaaggtataagacaaacttgtagt |
230 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8793460 |
tatgttttccgtaaggaaaagtggtagcgtcacttgccacatctaaaacctaaggtataagacaaacttgtagt |
8793387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 37 - 96
Target Start/End: Complemental strand, 8793630 - 8793571
Alignment:
| Q |
37 |
atcatctattttttgatctcggttctctgccgctgcgtgtagatatacattggtttattc |
96 |
Q |
| |
|
|||||||||||||| |||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8793630 |
atcatctatttttttatctcgattctctgccactgcgtgtagatatacattggtttattc |
8793571 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University