View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_high_22 (Length: 238)
Name: NF13129_high_22
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_high_22 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 1 - 235
Target Start/End: Original strand, 10470283 - 10470498
Alignment:
| Q |
1 |
ttgatgtgtcttagagtggagtcgatggtagcataaaggttaagttgaaatctacaaaattatgcagtatatgacgctatacattaatgaggggaagctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
10470283 |
ttgatgtgtcttagagtggagtcgatggtagcataaaggttaagttgaaatctacaaaattatgcagtatatgatgttatacattaatgagggga----- |
10470377 |
T |
|
| Q |
101 |
aatttgtcatggaagctagtagtgatattcacaatgtatggcaaggagctgcagattttcttctgcagaattttgcagtaaatgggctggttgtaggtgc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470378 |
--------------gctagtagtgatattcacaatgtatggcaaggagctgcagattttcttctgcagaattttgcagtaaatgggctggttgtaggtgc |
10470463 |
T |
|
| Q |
201 |
tttgaggtaatgccatgttgtgggttgggagtgat |
235 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
10470464 |
tttgaggtaatgccatgttgtgggttgggagtgat |
10470498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University