View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_high_26 (Length: 218)
Name: NF13129_high_26
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_high_26 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 33 - 218
Target Start/End: Complemental strand, 34349999 - 34349814
Alignment:
| Q |
33 |
ctgccacgaccctactcagaaggagtgttaccaggttaagcgacatcatgagaagcctgagcaacttgaacaacatgatgcactaacattaccaccgacc |
132 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349999 |
ctgccacgaccctactcaaaagcagtgttaccaggttaagcgacatcatgagaagcatgagcaacttgaacaacatgatgcactaacattaccaccgacc |
34349900 |
T |
|
| Q |
133 |
cttgatgtttttcctgggagcccttctgatatatctttattgtcgtcatcgctaatcatgttgcttacatgatttggaatgacgtt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34349899 |
cttgatgtttttcctgggagcccttctgatatatctttattgtcgtcatcgctaatcatgttgcttacatgatttggaatgacgtt |
34349814 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University