View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_low_16 (Length: 323)
Name: NF13129_low_16
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_low_16 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 173 - 312
Target Start/End: Complemental strand, 10469281 - 10469142
Alignment:
| Q |
173 |
gtggtggtggttacattgtagggggatgttaattccgggtgaaatcgctgctgaatcatacaaaaaagcagttgaatcagcgattcagaaactgagagat |
272 |
Q |
| |
|
|||| ||||||| |||||||| || | |||||||||| ||| |||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10469281 |
gtggcggtggttgcattgtagtggaaagttaattccgagtggaatcgctgatgactcatacaaaaaagcagttgaatcagcgattcagaaactgagagat |
10469182 |
T |
|
| Q |
273 |
gaggaagtagaagaagatgatgaagaagccaatgatgatg |
312 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10469181 |
gaggaagttgaagaagatgatgaagaagccaatgatgatg |
10469142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 20 - 71
Target Start/End: Complemental strand, 10469434 - 10469383
Alignment:
| Q |
20 |
gataacagagaaatttcttttaacagccaaaatttgtaataaaataaatacg |
71 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
10469434 |
gataacagattaatttcttttaacagccaaaatttctaataaaataaatacg |
10469383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University