View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13129_low_23 (Length: 237)
Name: NF13129_low_23
Description: NF13129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13129_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 11 - 223
Target Start/End: Original strand, 47376877 - 47377089
Alignment:
| Q |
11 |
cacagatacaaagtctgcataccacaaatttcctcctacctaaagtaagacccacatattttgatgatgatttaaatatttcaacttcaactatttattc |
110 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
47376877 |
cacaaatacaaagtctgcataccacaaatttcctcctacctaaagtaagacccacatattttgatgatgatttaaatattttaacttcaactatttattc |
47376976 |
T |
 |
| Q |
111 |
tctgtttatctccatattcagaatagattcaaaatccaaacaattggtagggagaaagtaagtgtgtcagcacattgaactatatactataatttctcta |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47376977 |
tctgtttatctccatattcagaatagattcaaaatccaaacaattggtagggagaaagtaagtgtgtcagcacattgaactatatactataatttctcta |
47377076 |
T |
 |
| Q |
211 |
cgtgaagcaaatt |
223 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47377077 |
cgtgaagcaaatt |
47377089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University