View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1312_low_2 (Length: 589)

Name: NF1312_low_2
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1312_low_2
NF1312_low_2
[»] chr5 (5 HSPs)
chr5 (123-360)||(35854447-35854688)
chr5 (19-161)||(35802661-35802803)
chr5 (222-409)||(10521309-10521496)
chr5 (168-290)||(35802504-35802630)
chr5 (30-106)||(10521033-10521109)
[»] chr4 (12 HSPs)
chr4 (229-378)||(47293471-47293620)
chr4 (229-381)||(55705896-55706048)
chr4 (229-359)||(45876736-45876866)
chr4 (229-380)||(56208510-56208661)
chr4 (233-347)||(45858817-45858931)
chr4 (255-378)||(54304265-54304388)
chr4 (22-123)||(45878670-45878771)
chr4 (22-123)||(55705599-55705700)
chr4 (55-123)||(47293221-47293289)
chr4 (22-113)||(56208881-56208972)
chr4 (23-66)||(54304073-54304116)
chr4 (23-79)||(45860198-45860254)
[»] chr8 (3 HSPs)
chr8 (229-377)||(7972058-7972206)
chr8 (229-376)||(7961689-7961836)
chr8 (34-123)||(7972415-7972504)
[»] chr2 (2 HSPs)
chr2 (228-360)||(24357469-24357601)
chr2 (22-123)||(24354011-24354112)


Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 5)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 123 - 360
Target Start/End: Original strand, 35854447 - 35854688
Alignment:
123 tcgaggaagggtttctcaaaactttaaccttgacaatgacaatgacaaagtgctagatagtgtggttcgtttgagattaatgactctaggcaagt----c 218  Q
    |||||||| ||||||||||||||||||||||||||||||  |||  ||||||||||||| |||||||| ||||||||||||||||||||||||||    |    
35854447 tcgaggaaaggtttctcaaaactttaaccttgacaatgatgatgtgaaagtgctagataatgtggttcatttgagattaatgactctaggcaagttagac 35854546  T
219 aacatgaaaaaggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgcta 318  Q
    || |||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
35854547 aagatgaaaaaggttgcacatgggaggatttggaccggtaaggacgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgcta 35854646  T
319 tagcaaaattgaaggccaatatacctcaaaacagacaggtta 360  Q
    ||||||||||||||||||||||||||||||||||||||||||    
35854647 tagcaaaattgaaggccaatatacctcaaaacagacaggtta 35854688  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 123; E-Value: 7e-63
Query Start/End: Original strand, 19 - 161
Target Start/End: Complemental strand, 35802803 - 35802661
Alignment:
19 cccgtcattacttcaatgtctgatgtggcaataagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaaccggtt 118  Q
    ||||||||| ||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||    
35802803 cccgtcattgcttcaatgtctgatgcggcaacaagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaactggtt 35802704  T
119 caattcgaggaagggtttctcaaaactttaaccttgacaatga 161  Q
    |||||||||||| ||||||||||||||||||||||||||||||    
35802703 caattcgaggaacggtttctcaaaactttaaccttgacaatga 35802661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 222 - 409
Target Start/End: Original strand, 10521309 - 10521496
Alignment:
222 atgaaaaaggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatag 321  Q
    |||||| || || ||||| ||||||||| || ||| ||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |    
10521309 atgaaagagattccacataggaggatttggatcgggaaggacgcagcatctcaaggtttggttgatgctattggtgggatatcgcgtgctattgctatcg 10521408  T
322 caaaattgaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaagatatggtcctactctacgcatgctcttaag 409  Q
    ||||||| |||||||||||||||||||||| |||||||| |||||| |||||||||||||  |||||| |||||||||| || |||||    
10521409 caaaattcaaggccaatatacctcaaaacaaacaggttaatcttgtcgagctctcaagatccggtccttctctacgcatacttttaag 10521496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 86; E-Value: 8e-41
Query Start/End: Original strand, 168 - 290
Target Start/End: Complemental strand, 35802630 - 35802504
Alignment:
168 caaagtgctagatagtgtggttcgtttgagattaatgactctaggcaagt----caacatgaaaaaggttgcacatgggaggatttagaccggtaaggat 263  Q
    |||||||||||||| ||||||||||||||| ||||||||||| |||||||    ||| |||||||||||||||||||||||||||| ||||||||||||     
35802630 caaagtgctagataatgtggttcgtttgaggttaatgactctcggcaagttagacaagatgaaaaaggttgcacatgggaggatttggaccggtaaggac 35802531  T
264 gcagcatctcatggtttggttgatgct 290  Q
    |||||||||||||||||||||||||||    
35802530 gcagcatctcatggtttggttgatgct 35802504  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 57; E-Value: 2e-23
Query Start/End: Original strand, 30 - 106
Target Start/End: Original strand, 10521033 - 10521109
Alignment:
30 ttcaatgtctgatgtggcaataagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatctta 106  Q
    ||||||||||||||| |||  ||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||    
10521033 ttcaatgtctgatgtagcagcaagtgcaggatactacatggcaacgggagcaggagatatcgtagcagaaaatctta 10521109  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 106; Significance: 9e-53; HSPs: 12)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 106; E-Value: 9e-53
Query Start/End: Original strand, 229 - 378
Target Start/End: Original strand, 47293471 - 47293620
Alignment:
229 aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt 328  Q
    |||||||||| || ||||||| |||| ||||||| |||| ||||||||||||||||||||||||||||||  ||||||| ||||||||||||||||||||    
47293471 aggttgcacagggaaggatttggaccagtaaggacgcagtatctcatggtttggttgatgctattggtggactatcgcgcgctattgctatagcaaaatt 47293570  T
329 gaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaa 378  Q
    |||||||||||||||||||||||||||||| ||||||||||||| |||||    
47293571 gaaggccaatatacctcaaaacagacaggtcactcttgtggagcgctcaa 47293620  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 105; E-Value: 4e-52
Query Start/End: Original strand, 229 - 381
Target Start/End: Original strand, 55705896 - 55706048
Alignment:
229 aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt 328  Q
    ||||||| ||||||||| ||| ||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||    
55705896 aggttgcgcatgggagggtttggaccggtaaagacgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctattacaaaatt 55705995  T
329 gaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaagat 381  Q
    ||| || |||||||||||||||||| |||||| | ||||||||||||||||||    
55705996 gaaagctaatatacctcaaaacagagaggttattgttgtggagctctcaagat 55706048  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 95; E-Value: 3e-46
Query Start/End: Original strand, 229 - 359
Target Start/End: Complemental strand, 45876866 - 45876736
Alignment:
229 aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt 328  Q
    |||||||||| |||||| ||| ||||||||||||||||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
45876866 aggttgcacaagggagggtttggaccggtaaggatgcagcatcccatggtttggttgatgctattggtgggctatctcgtgctattgctatagcaaaatt 45876767  T
329 gaaggccaatatacctcaaaacagacaggtt 359  Q
    ||| || |||||||||||| |||||||||||    
45876766 gaaagctaatatacctcaagacagacaggtt 45876736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 229 - 380
Target Start/End: Complemental strand, 56208661 - 56208510
Alignment:
229 aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt 328  Q
    |||||||||| |||||| ||||||||||||| ||||||  ||||| ||||||||||||||||||||||||| |||| |||||||||||||||||||||||    
56208661 aggttgcacaggggagggtttagaccggtaaagatgcactatctcttggtttggttgatgctattggtgggctatctcgtgctattgctatagcaaaatt 56208562  T
329 gaaggccaatatacctcaaaacagacaggttactcttgtggagctctcaaga 380  Q
    ||||||   |||||||||| ||| ||| |||||| |||||||  ||||||||    
56208561 gaaggctggtatacctcaagacaaacatgttactgttgtggacatctcaaga 56208510  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 233 - 347
Target Start/End: Complemental strand, 45858931 - 45858817
Alignment:
233 tgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaattgaag 332  Q
    |||||| | |||| ||| ||||||||||||||||| |||||||||| |||||||||||||||||||| |||| ||||||||||||||||| |||||||||    
45858931 tgcacaggagagggtttggaccggtaaggatgcagtatctcatggtctggttgatgctattggtgggctatcacgtgctattgctatagccaaattgaag 45858832  T
333 gccaatatacctcaa 347  Q
    |||||||||||||||    
45858831 gccaatatacctcaa 45858817  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 255 - 378
Target Start/End: Original strand, 54304265 - 54304388
Alignment:
255 ggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaattgaaggccaatatacctcaaaacagac 354  Q
    |||||||| ||| ||||||  |||||||||||||||||||| ||||| || |||||||||||||||||||||||||||||||||||||||||||| ||      
54304265 ggtaaggacgcaacatctctcggtttggttgatgctattggcgggatgtctcgtgctattgctatagcaaaattgaaggccaatatacctcaaaatagtg 54304364  T
355 aggttactcttgtggagctctcaa 378  Q
    ||||||||||||| || |||||||    
54304365 aggttactcttgttgaactctcaa 54304388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 62; E-Value: 2e-26
Query Start/End: Original strand, 22 - 123
Target Start/End: Complemental strand, 45878771 - 45878670
Alignment:
22 gtcattacttcaatgtctgatgtggcaataagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaaccggttcaa 121  Q
    |||||| ||||||||||||||||||||  ||||| ||||||||||||||||||||||||||||||||| || ||||||| ||| || ||||| |||||||    
45878771 gtcattgcttcaatgtctgatgtggcagcaagtggaggatactacatggcaatgggagcaggagctattgttgcagaaagtctaaccttaactggttcaa 45878672  T
122 tt 123  Q
    ||    
45878671 tt 45878670  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #8
Raw Score: 46; E-Value: 6e-17
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 55705599 - 55705700
Alignment:
22 gtcattacttcaatgtctgatgtggcaataagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaaccggttcaa 121  Q
    |||||| ||||||||| ||| ||||||   ||||||||||| ||||||||||||||||| |||   || ||||||||||||||||| ||||| |||||||    
55705599 gtcattgcttcaatgtatgacgtggcagccagtgcaggatagtacatggcaatgggagctggaataatagtagcagaaaatcttacattaactggttcaa 55705698  T
122 tt 123  Q
    ||    
55705699 tt 55705700  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #9
Raw Score: 41; E-Value: 0.00000000000006
Query Start/End: Original strand, 55 - 123
Target Start/End: Original strand, 47293221 - 47293289
Alignment:
55 gcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaaccggttcaatt 123  Q
    |||||||||||| |||||||||| ||||||| ||| || |||||||||||||| ||||| |||||||||    
47293221 gcaggatactacgtggcaatgggcgcaggagttattgttgcagaaaatcttaccttaactggttcaatt 47293289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #10
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 22 - 113
Target Start/End: Complemental strand, 56208972 - 56208881
Alignment:
22 gtcattacttcaatgtctgatgtggcaataagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaac 113  Q
    |||||| |||| |||||| || || ||  ||||| ||||||| ||||||||||||||||||||| ||| || |||||||||||||| |||||    
56208972 gtcattgcttcgatgtctcatatgacagcaagtggaggataccacatggcaatgggagcaggagttattgttgcagaaaatcttaccttaac 56208881  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 23 - 66
Target Start/End: Original strand, 54304073 - 54304116
Alignment:
23 tcattacttcaatgtctgatgtggcaataagtgcaggatactac 66  Q
    ||||| ||||||| ||||||||||||| ||||||||||||||||    
54304073 tcattgcttcaatatctgatgtggcaacaagtgcaggatactac 54304116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #12
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 23 - 79
Target Start/End: Complemental strand, 45860254 - 45860198
Alignment:
23 tcattacttcaatgtctgatgtggcaataagtgcaggatactacatggcaatgggag 79  Q
    ||||| ||||||||||||||||||||   |||| ||||||||| ||||| |||||||    
45860254 tcattgcttcaatgtctgatgtggcagctagtggaggatactatatggcgatgggag 45860198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 89; Significance: 1e-42; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 89; E-Value: 1e-42
Query Start/End: Original strand, 229 - 377
Target Start/End: Complemental strand, 7972206 - 7972058
Alignment:
229 aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt 328  Q
    ||||||||||  ||||||||| ||||||||| ||||||| |||| |||||||||| ||||||||  ||||  ||||||||||||||||||||||||||||    
7972206 aggttgcacagaggaggatttggaccggtaaagatgcagtatctaatggtttggtcgatgctatcagtggactatcgcgtgctattgctatagcaaaatt 7972107  T
329 gaaggccaatatacctcaaaacagacaggttactcttgtggagctctca 377  Q
    |||||||||| | |||||||||||||| |||||| ||||||||||||||    
7972106 gaaggccaatcttcctcaaaacagacatgttactattgtggagctctca 7972058  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 76; E-Value: 7e-35
Query Start/End: Original strand, 229 - 376
Target Start/End: Complemental strand, 7961836 - 7961689
Alignment:
229 aggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaatt 328  Q
    |||||||||| ||||| |||| ||| ||||| ||||||  |||| ||| |||||| |||||||||||||| |||||||  ||||||||||||||||||||    
7961836 aggttgcacaagggagaatttggactggtaaagatgcaatatctaatgatttggtcgatgctattggtggaatatcgcacgctattgctatagcaaaatt 7961737  T
329 gaaggccaatatacctcaaaacagacaggttactcttgtggagctctc 376  Q
    |||||||||||| |||||||||| ||| |||||| |||||||| ||||    
7961736 gaaggccaatattcctcaaaacaaacatgttactattgtggagttctc 7961689  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 34 - 123
Target Start/End: Complemental strand, 7972504 - 7972415
Alignment:
34 atgtctgatgtggcaataagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaaccggttcaatt 123  Q
    ||||||||| ||||||| || ||||||||||||||||||||||| ||||||| ||| || |||||||| ||||| ||||| |||||||||    
7972504 atgtctgatctggcaatgagcgcaggatactacatggcaatgggcgcaggagttattgttgcagaaaaccttaccttaactggttcaatt 7972415  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 65; Significance: 3e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 3e-28
Query Start/End: Original strand, 228 - 360
Target Start/End: Original strand, 24357469 - 24357601
Alignment:
228 aaggttgcacatgggaggatttagaccggtaaggatgcagcatctcatggtttggttgatgctattggtgggatatcgcgtgctattgctatagcaaaat 327  Q
    ||||| ||||| |||||  ||| ||| ||||| ||||||||||| ||||||||||||||||||||||||||  | || || |||||||| ||||||||||    
24357469 aaggtagcacaggggagagtttggactggtaaagatgcagcatcacatggtttggttgatgctattggtggcctttcccgagctattgccatagcaaaat 24357568  T
328 tgaaggccaatatacctcaaaacagacaggtta 360  Q
    |||||||||||||||||||| ||  ||||||||    
24357569 tgaaggccaatatacctcaagacgaacaggtta 24357601  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 22 - 123
Target Start/End: Original strand, 24354011 - 24354112
Alignment:
22 gtcattacttcaatgtctgatgtggcaataagtgcaggatactacatggcaatgggagcaggagctatcgtagcagaaaatcttactttaaccggttcaa 121  Q
    |||||| |||| ||| |||||||||||  ||||| |||||||||||||||||||||| | |  ||||| || ||||||| |||||| ||||| |||||||    
24354011 gtcattgcttcgatggctgatgtggcagcaagtggaggatactacatggcaatgggaactgatgctattgttgcagaaagtcttaccttaactggttcaa 24354110  T
122 tt 123  Q
    ||    
24354111 tt 24354112  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University