View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1312_low_25 (Length: 287)
Name: NF1312_low_25
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1312_low_25 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 19 - 258
Target Start/End: Original strand, 39794365 - 39794604
Alignment:
| Q |
19 |
attattctctcgtattaatgcgatgtcatttagctttgttttgtcacttttaagtgaaaaatacataacaaacgattgtcattacacaataacctaacac |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794365 |
attattctctcgtattaatgcgatgtcatttagctttgttttgtcacttttaagtgaaaaatacataacaaacgattgtcattacacaataacctaacac |
39794464 |
T |
 |
| Q |
119 |
acattttacataaggaaatttggagttttgccaatggacaaccggtgtaaccagttaccaagtaaaaagtcattttatgggcaagctatctaactggtaa |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39794465 |
acattttacataaggaaatttggagttttgccaatgaacaaccggtgtaaccggttaccaagtaaaaagtcattttatgggcaagctatctaactggtaa |
39794564 |
T |
 |
| Q |
219 |
ccggttacctgtccctaaacattgttttcaggccctctat |
258 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
39794565 |
ccggttacctgtcccaaaacattgttttaaggccctctat |
39794604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University