View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1312_low_27 (Length: 257)
Name: NF1312_low_27
Description: NF1312
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1312_low_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 29 - 241
Target Start/End: Complemental strand, 30167317 - 30167105
Alignment:
| Q |
29 |
agttgaaacagatttcgcaagattttcatgtatgcgacgaaattaaaacagattgattttgtttctcttcattagaagtttcgatagtagtaaattgacc |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30167317 |
agttgaaacagatttcgcaagattttcatgtatgcgacgaaattaaaacagattgattttgtttctcttcattagaagtttcgatagtagtaaattgacc |
30167218 |
T |
 |
| Q |
129 |
aaacctgcatcactatccaatgttcactagttcaagaaatttttagttatatgagagcaatttattgaactagtccttgaattaccaacacaagctgaag |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30167217 |
aaacctgcatcactatccaatgttcactagttcaagaaatttttagttatacgagagcaatttattgaactagtccttgaattaccaacacaagctgaag |
30167118 |
T |
 |
| Q |
229 |
taacttttgctaa |
241 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30167117 |
taacttttgctaa |
30167105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 139 - 238
Target Start/End: Original strand, 43163377 - 43163473
Alignment:
| Q |
139 |
cactatccaatgttcactagttcaagaaatttttagttatatgagagcaatttattgaactagtccttgaattaccaacacaagctgaagtaacttttgc |
238 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| | ||||| || |||||||||||||| ||||||||||||||||||||| | ||||||||||||||| |
|
|
| T |
43163377 |
cactatccaatgttcaatagttcattaaatt---acttatacgacggcaatttattgaacaagtccttgaattaccaacacaggttgaagtaacttttgc |
43163473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University