View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313-Insertion-2 (Length: 316)
Name: NF1313-Insertion-2
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313-Insertion-2 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-121; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-121
Query Start/End: Original strand, 8 - 278
Target Start/End: Original strand, 42054163 - 42054430
Alignment:
| Q |
8 |
ggatgatgggtccatccgccatggcctccggtggtggatcttatgtgggttttgctgagactaaaactaaaatgtgaatgtgaaagtggatacacacaca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42054163 |
ggatgatgggtccatccgccatggcctccggtggtggatcttatgtgggttttgctgagactaaaactaaaatgtgaatgtgaaagtggatacacacaca |
42054262 |
T |
|
| Q |
108 |
taacagagtataagggaaggatgaagtaaaagccaaagacaatttattttatcaaaccaaaccaaaccccacatgttgtccctctcaaaaattaaaagta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
42054263 |
taacagagtataagggaaggatgaagtaaaagccaaagacaatttattttat-----caaaccaaaccccacatgttgtccctctcaaaaatttaaagta |
42054357 |
T |
|
| Q |
208 |
agaaattggtcaagggatattgaaatgactttttaatttgtag-cggaaaaa-tcacactccctcatcataat |
278 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||| |||||||| | |||||||||| ||||||| |
|
|
| T |
42054358 |
agaaattggtcaagggatattgaaatgagtttttaatttgtagacggaaaaatttacactccctcgtcataat |
42054430 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University