View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1313-Insertion-8 (Length: 101)
Name: NF1313-Insertion-8
Description: NF1313
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1313-Insertion-8 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 29; Significance: 0.0000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000001
Query Start/End: Original strand, 73 - 101
Target Start/End: Complemental strand, 52324903 - 52324875
Alignment:
| Q |
73 |
atgattaggggcatatgatcattatggag |
101 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52324903 |
atgattaggggcatatgatcattatggag |
52324875 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University