View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13130_high_8 (Length: 245)

Name: NF13130_high_8
Description: NF13130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13130_high_8
NF13130_high_8
[»] scaffold0012 (1 HSPs)
scaffold0012 (19-101)||(145753-145835)


Alignment Details
Target: scaffold0012 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0012
Description:

Target: scaffold0012; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 145835 - 145753
Alignment:
19 tcatgttgatctcgaaacccagttcggacatcctaatggtcaaaattgtgaattactgaaccagtaaagttgactgcgggtca 101  Q
    |||||||| |||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||    
145835 tcatgttggtctcgaaacccagttcagacatcctaattgtcaaaattgtgaattactgaaccagtaaagttgactgcgggtca 145753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University