View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13130_low_6 (Length: 248)
Name: NF13130_low_6
Description: NF13130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13130_low_6 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 7292480 - 7292709
Alignment:
| Q |
19 |
cataccacattcttcatcatgattttggttacacatatggaaatcccccagttcttgctaactacacccctccctctcattgctcatttaaaaaattctc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7292480 |
cataccacattcttcatcatgattttggttacacatatggaaatcccccagttcttgctaactacacccctccctctcattgctcatttaaaaaattctc |
7292579 |
T |
 |
| Q |
119 |
caaaattgttcttgaatggaaagcaacatgcgagggaagacaatatgatcgaattttcggtgtttggcttggtggagttgagttactcagaagctgtact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7292580 |
caaaattgttcttgaatggaaagcaacatgcgagggaagacaatatgatcgaattttcggtgtttggcttggtggagttgagttactcagaagctgtact |
7292679 |
T |
 |
| Q |
219 |
gcagaaccaatagcaaatgggattgtttgg |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
7292680 |
gcagaaccaatagcaaatgggattgtttgg |
7292709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 19 - 248
Target Start/End: Original strand, 7288722 - 7288951
Alignment:
| Q |
19 |
cataccacattcttcatcatgattttggttacacatatggaaatcccccagttcttgctaactacacccctccctctcattgctcatttaaaaaattctc |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| || | ||||||||| |
|
|
| T |
7288722 |
cataccacattcttcatcatgattttggttacacatatggaaacccaccagttcttgctaattacaccccaccttcacattgcttatattcaaaattctc |
7288821 |
T |
 |
| Q |
119 |
caaaattgttcttgaatggaaagcaacatgcgagggaagacaatatgatcgaattttcggtgtttggcttggtggagttgagttactcagaagctgtact |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||||| |||||||||||| ||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
7288822 |
caaaattgttcttgaatggaaagcaacatgtgaaggaagacaatttgatcgaatttttggtgtttggcttgatggtgttgagttactcagaagctgtact |
7288921 |
T |
 |
| Q |
219 |
gcagaaccaatagcaaatgggattgtttgg |
248 |
Q |
| |
|
|||||||||| | |||||||||||||||| |
|
|
| T |
7288922 |
gcagaaccaagacaaaatgggattgtttgg |
7288951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University