View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13130_low_7 (Length: 247)
Name: NF13130_low_7
Description: NF13130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13130_low_7 |
 |  |
|
| [»] scaffold0060 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 55; Significance: 1e-22; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 82 - 148
Target Start/End: Complemental strand, 13476665 - 13476599
Alignment:
| Q |
82 |
gattgtatttctacttaattgaatctttactttggaatatgaacttcacatcatgttaatttttgag |
148 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13476665 |
gattgtatttctacttaattgaatattttctttggaacatgaacttcacatcatgttaatttttgag |
13476599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 157 - 225
Target Start/End: Complemental strand, 13476364 - 13476296
Alignment:
| Q |
157 |
cttacatagtgcggaaaaatgcaaagttgcagacagagtgcgaaaccaattattcattaatgatagatt |
225 |
Q |
| |
|
|||||| ||||| ||||||||||||||||||||||||||||||||||||| | |||||| |||||||| |
|
|
| T |
13476364 |
cttacaaagtgcaaaaaaatgcaaagttgcagacagagtgcgaaaccaattctacattaacgatagatt |
13476296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 171 - 247
Target Start/End: Original strand, 13930393 - 13930468
Alignment:
| Q |
171 |
aaaaatgcaaagttgcagacagagtgcgaaaccaattattcattaatgatagattattacatgtgtgtgttatgttt |
247 |
Q |
| |
|
||||||||||||||||| ||||||||| |||| |||| | |||||| ||||| || |||||||| ||||||| |||| |
|
|
| T |
13930393 |
aaaaatgcaaagttgcaaacagagtgcaaaacaaattctacattaacgataggttcttacatgt-tgtgttaagttt |
13930468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 20809062 - 20809014
Alignment:
| Q |
17 |
acatcaaatataattcttgtctgagcaatagtgcactgactgacgagta |
65 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||||||||||||||| |
|
|
| T |
20809062 |
acatcaaatataattcccatctgagtaatagtgcactgactgacgagta |
20809014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0060 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0060
Description:
Target: scaffold0060; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 17 - 65
Target Start/End: Complemental strand, 38064 - 38016
Alignment:
| Q |
17 |
acatcaaatataattcttgtctgagcaatagtgcactgactgacgagta |
65 |
Q |
| |
|
|||||||||| |||||| |||||| ||||| ||||||||||||||||| |
|
|
| T |
38064 |
acatcaaataaaattctcatctgagtaatagcgcactgactgacgagta |
38016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University