View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13130_low_8 (Length: 245)
Name: NF13130_low_8
Description: NF13130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13130_low_8 |
 | |
|
| [»] scaffold0012 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0012 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: scaffold0012
Description:
Target: scaffold0012; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 19 - 101
Target Start/End: Complemental strand, 145835 - 145753
Alignment:
| Q |
19 |
tcatgttgatctcgaaacccagttcggacatcctaatggtcaaaattgtgaattactgaaccagtaaagttgactgcgggtca |
101 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
145835 |
tcatgttggtctcgaaacccagttcagacatcctaattgtcaaaattgtgaattactgaaccagtaaagttgactgcgggtca |
145753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University