View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13131_high_7 (Length: 319)
Name: NF13131_high_7
Description: NF13131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13131_high_7 |
 |  |
|
| [»] scaffold1113 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 170; Significance: 3e-91; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 170; E-Value: 3e-91
Query Start/End: Original strand, 127 - 304
Target Start/End: Complemental strand, 32684226 - 32684049
Alignment:
| Q |
127 |
tagaatcaagattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttgagat |
226 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684226 |
tagaatcaaaattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctacaatttatcttcgaccaaatttgagat |
32684127 |
T |
 |
| Q |
227 |
tcttacaatgatatccacacaccttcatgtcaaattcccctatctctgattcattcatgttatcacaggttcctaact |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32684126 |
tcttacaatgatatccacacaccttcatgtcaaatttccctatctctgattcattcatgttatcacaggttcctaact |
32684049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 32684352 - 32684284
Alignment:
| Q |
1 |
aacctcctctttatattcagccttggatttcagcgcacaattcaactgccagatctgctggtttagagg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
32684352 |
aacctcctctttatattcagccttggatttcagcgcacaattcagctgccagatctgctggtttagagg |
32684284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 32692250 - 32692182
Alignment:
| Q |
1 |
aacctcctctttatattcagccttggatttcagcgcacaattcaactgccagatctgctggtttagagg |
69 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
32692250 |
aacctcctctttatattcaaccttgcatttcagcacacaattcagctgccagatctgctggtttagagg |
32692182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 127 - 161
Target Start/End: Complemental strand, 32692124 - 32692090
Alignment:
| Q |
127 |
tagaatcaagattattgttagagaaaaacttgcct |
161 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |
|
|
| T |
32692124 |
tagaatcaaaattattgttagagaaaaacttgcct |
32692090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1113 (Bit Score: 62; Significance: 9e-27; HSPs: 1)
Name: scaffold1113
Description:
Target: scaffold1113; HSP #1
Raw Score: 62; E-Value: 9e-27
Query Start/End: Original strand, 127 - 200
Target Start/End: Original strand, 61 - 134
Alignment:
| Q |
127 |
tagaatcaagattattgttagagaaaaacttgccttgaatgctaaatcagcatccggctcattcatgcgtctac |
200 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
61 |
tagaatcaaaattattgttagagaaaaacttgcctcgaatgctaaatcagcatccggctcattcacgcgtctac |
134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University