View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13131_low_8 (Length: 265)
Name: NF13131_low_8
Description: NF13131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13131_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 32835244 - 32835486
Alignment:
| Q |
1 |
acaataaatgaagcaaagtaaatggaacaaagtcgaactcatgtataaattggttgatcatactaattgtatataccaaaatatagtctattgtgtgcca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
32835244 |
acaataaatgaagcaaagtaaatggaacaaagtcgaactcgtgtataaattggttgaccatactaattatatataccaaa-tatagtctattgtgtgcca |
32835342 |
T |
 |
| Q |
101 |
tgtaaatcaactttctcactaatctatgatgttgacccttgtcaacttaacatttttcaccttaaaagcttaacctatgattttgcttgataagaacaca |
200 |
Q |
| |
|
|||||||||||||||||| |||||| |||| |||||||||||||||||||||||||||||||| |||||||||| |||||||||||| |||||||||||| |
|
|
| T |
32835343 |
tgtaaatcaactttctcattaatctctgatattgacccttgtcaacttaacatttttcacctt-aaagcttaacttatgattttgctcgataagaacaca |
32835441 |
T |
 |
| Q |
201 |
tgtaagtttgcatccaagtttttctatttcccgcaaaagatcaaa |
245 |
Q |
| |
|
||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
32835442 |
tgtaattttgcatccaagtttttctatttcctacaaaagatcaaa |
32835486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 42
Target Start/End: Complemental strand, 2871880 - 2871839
Alignment:
| Q |
1 |
acaataaatgaagcaaagtaaatggaacaaagtcgaactcat |
42 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||||||||| |
|
|
| T |
2871880 |
acaataaatgaagtaaagtaaatggaacaaagccgaactcat |
2871839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University