View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13131_low_9 (Length: 237)
Name: NF13131_low_9
Description: NF13131
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13131_low_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 24224792 - 24224567
Alignment:
| Q |
1 |
ttaaacttccttgctgactctaataacaaattcgttggtgttggaatcaaagaagatgttgacaagcttatgaaagattataatattaccgtttcgaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224792 |
ttaaacttccttgctgactctaataacaaattcgttggtgttggaatcaaagaagatgttgacaagcttatgaaagattataatattaccgtttcgaatt |
24224693 |
T |
|
| Q |
101 |
acgttgatttgagaaaccttgccgctgaggtcatggatgatcaggaaatgttgaagactgggattaagagtttgacgcaaaaggtgattgggaaaactct |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24224692 |
acgttgatttgagaaaccttgctgctgaggtcatggatgatcatgaaatgttgaagactgggattaagagtttgacgcaaaaggtgattgggaaaactct |
24224593 |
T |
|
| Q |
201 |
tgtgaaaccaaagaaggttttgatga |
226 |
Q |
| |
|
||||||||| |||||||||| ||||| |
|
|
| T |
24224592 |
tgtgaaaccgaagaaggtttcgatga |
24224567 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University