View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13132_low_7 (Length: 375)
Name: NF13132_low_7
Description: NF13132
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13132_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 39 - 336
Target Start/End: Original strand, 46751524 - 46751816
Alignment:
| Q |
39 |
ttaaaattattattaataacgacaatactaactaataatcattttacgattatctcgtatataataaaataaaatcaaactcttaccatcgaactgaatg |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| | |
|
|
| T |
46751524 |
ttaaaattattattaataacgacaatactaactaataatcattttacgattatctcgtatataata-----aaatcaaactcttaccatcgaactgacgg |
46751618 |
T |
|
| Q |
139 |
ctcatcgcagtctgattcactatggagtatgataatttgttggcattgagagttgtcatatacttttgctcttatatccatgtcttgtaatgttttgttt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751619 |
ctcatcgcagtctgattcactatggagtgtgataatttgttggcattgagagttgtcatatacttttgctcttatatccatgtcttgtaatgttttgttt |
46751718 |
T |
|
| Q |
239 |
ttgtatgaaaggaattgaattttgagaatgtagttgtatatgtttggtaaccgttttaaaaatgacttgtcttcttcccaccacctgctgtctttctt |
336 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
46751719 |
ttgtatgaaaggaattgaattttgagaatgtagttgtatatgtttggtaaccgttttaaaattgacttgtcttcttcccaccacctgctgtctttctt |
46751816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 30
Target Start/End: Original strand, 46751481 - 46751510
Alignment:
| Q |
1 |
tctcaatcacattttttaaaggccgggatg |
30 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
46751481 |
tctcaatcacattttttaaaggccgggatg |
46751510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University