View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_high_24 (Length: 398)
Name: NF13133_high_24
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_high_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 292; Significance: 1e-164; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 292; E-Value: 1e-164
Query Start/End: Original strand, 9 - 345
Target Start/End: Complemental strand, 810644 - 810301
Alignment:
| Q |
9 |
gattatactatatttgaatgtcaaattatagaaattaaactcaacaaaagtgaaaattttaatatgatcttccaaacacctgatatgtgagagtaatatg |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
810644 |
gattatactatatttgaatgtcaaattatagaaaccaaactcaacaaaagtgaaaattttaatatgatcttccaaacacctgatatgtgagagtaatatg |
810545 |
T |
 |
| Q |
109 |
tggatgaagtactttaacatgatctgatctgcattattcatgtctttggaatgttttgatgagttcatgagattgtttctgaactattgttgtgaaatca |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
810544 |
tggatgaagtactttaacatgatctgatctgcattattcatgtctttggaatgttttgatgagttcatgagattgtttctgaactattgttgtgaaatca |
810445 |
T |
 |
| Q |
209 |
tttttgagccgaatatgaagtacttgagtctttggcatatcataaccgatctttgttgtgataagtttgctatcatta--------aaaaaggtattgtg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
810444 |
tttttgagccgaatatgaagtacttgagtctttagcatatcataaccgatctttgttgtgataagtttgctatcattaaaacatctaaaaaggtattgtg |
810345 |
T |
 |
| Q |
301 |
tttttccgaagcaatttagacggtaatataattccctgcattgtt |
345 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
810344 |
tttttccgaaacaatttagacggtaatataatt-cctgcattgtt |
810301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 340 - 380
Target Start/End: Complemental strand, 810284 - 810245
Alignment:
| Q |
340 |
attgtttaaaagtatgtacttgtttatcattaagtcagata |
380 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
810284 |
attgtttaaaagta-gtacttgtttatcattaagtcagata |
810245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University