View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_high_29 (Length: 328)
Name: NF13133_high_29
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 19 - 315
Target Start/End: Original strand, 41765298 - 41765594
Alignment:
| Q |
19 |
ctttcctcccccgcgttaagatcaactcctccgttgaatattctgtcactgctggctccgatctctgtattgtcaccgccggtgcaagacagatcggtgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41765298 |
ctttcctcccccgcgttaagatcaactcctccgttgaatattctgtcactgctggctccgatctctgtattgtcaccgccggtgcaagacagatcggtgg |
41765397 |
T |
|
| Q |
119 |
cgagtctaggcttaatcttcttcagaggaatctttctctgttcaaggcgattatacctcctttggctcgttactcgccggaaacggttctgatcatcgtg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41765398 |
cgagtctaggcttaatcttcttcagaggaatctttctctgttcaaggcgattatacctcctttggctcgttactcgccggaaacggttctgatcatcgtg |
41765497 |
T |
|
| Q |
219 |
tctaaccccgttgatgttcttacctatatcgcatggaagctttctgggtttccttctaatcgggtcatcgggtcgggtaccaatttggattcatctc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41765498 |
tctaaccccgttgatgttcttacctatatcgcatggaagctttctgggtttccttctaatcgggtcatcgggtcgggtaccaatttggattcatctc |
41765594 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University