View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13133_high_41 (Length: 266)
Name: NF13133_high_41
Description: NF13133
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13133_high_41 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 176; Significance: 7e-95; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 1 - 253
Target Start/End: Complemental strand, 42987305 - 42987069
Alignment:
| Q |
1 |
ctttgtaaaatataagtcaactacttatcaactagatcaatctcgattggcaaatgatatctattatggcacatatcatttataaaaattaaaattaagg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
42987305 |
ctttgtaaaatataagtcaactacttatcaactagatcaatctcggttggcaaatgatatctattatggcacatatcgtttataaaaattaaaattaagg |
42987206 |
T |
|
| Q |
101 |
attttcattgaaaataaattttgaaaaccaaagatccatgaaaccaatgtccagctaatcataggagtgtcaaactcaaactcattctctttatgctgat |
200 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
42987205 |
attttcattgaaaataaattttgaaaa----------------ccaatgtccagctaatcataggagtgtcaaactcatactcattctctttatactgat |
42987122 |
T |
|
| Q |
201 |
gagattaagatttctgccaagatactacaaagaatttaaaaaatgctatgtct |
253 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
42987121 |
gagattacgatttctgccaagatactaaaaagaatttaaaaaatgctatgtct |
42987069 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 86 - 131
Target Start/End: Original strand, 35088150 - 35088194
Alignment:
| Q |
86 |
aaattaaaattaaggattttcattgaaaataaattttgaaaaccaa |
131 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
35088150 |
aaattaaaattcaggattt-cactgaaaataaattttgaaaaccaa |
35088194 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University